An Introduction to Protein Informatics by Karl-Heinz Zimmermann

By Karl-Heinz Zimmermann

Protein informatics is a more recent identify for an already latest self-discipline. It encompasses the strategies utilized in bioinformatics and molecular modeling which are with regards to proteins. whereas bioinformatics is especially interested by the gathering, association, and research of organic information, molecular modeling is dedicated to illustration and manipulation of the constitution of proteins.

Protein informatics calls for monstrous necessities on laptop technology, arithmetic, and molecular biology. The process selected right here, permits an immediate and fast clutch at the topic ranging from simple wisdom of set of rules layout, calculus, linear algebra, and chance theory.

An creation to Protein Informatics, a qualified monograph will give you the reader a finished advent to the sector of protein informatics. The textual content emphasizes mathematical and computational easy methods to take on the crucial difficulties of alignment, phylogenetic reconstruction, and prediction and sampling of protein constitution.

An advent to Protein Informatics is designed for a qualified viewers, composed of researchers and practitioners inside of bioinformatics, molecular modeling, set of rules layout, optimization, and trend acceptance. This e-book can also be appropriate as a graduate-level textual content for college kids in computing device technological know-how, arithmetic, and biomedicine.

Show description

Read Online or Download An Introduction to Protein Informatics PDF

Best nonfiction_1 books

Densification of Metal Powders During Sintering

Sintering of powder steel compacts is likely one of the simple oper­ ations in powder metallurgy. The important homes of a computer half are got after huge densification of the sintered fabric. even though the mechanical homes of the half depend upon different structural components along with porosity, porosity is the most issue.

Additional resources for An Introduction to Protein Informatics

Example text

The Protein Data Bank (PDB) maintained by Brookhaven National Laboratory contains all publically available solvent protein structures [16, 17]. The SWiSS-PROT database maintained at the University of Geneva is a highly curated, highly crossreferenced, nonredundant database [26]. The process of enhancing SWiSS-PROT is very labor intensive such that not every known protein is recorded in SWiSS-PROT. We have repeated many times that there are twenty naturally occurring amino acids. This is not quite true.

The consensus sequences 5'-TATAAT-3 ' and 5 ' -TTGACA-3' are AT-rich and therefore called TATA boxes. Both sequences usually lie 15 to 21 bp apart, the ideal spacing is 17 bp. For instance. the promoter region of the gene thrL in E. coli is -35 -10 -1 0 ... TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCIATG... TTGACA TATAAT The example shows that promoter sequences may differ from the consensus. The more the promoter resembles the consensus, the stronger the promoter. As a rule of thumb, the stronger the promoter the more frequently the gene is expressed, since RNA polymerase has higher affinity to stronger promoters.

The codon complementary and antiparallel to the anticodon corresponds to an amino acid as described by the genetic code. That amino acid can be bonded to the tRNA molecule by enzymes called tRNA synthetases. The tRNA molecules have a cloverleaf structure. A tRNA molecule of E. coli is illustrated in Fig. 17. It contains several unusual monomers like ribothymidine (7) and pseudouridine ('l/J). In the figure, the stem of the cloverleaf can carry the amino acid valine bonded to adenosine (A'). The anticodon is 3' -CAU-5' and lies in a loop of seven nucleotides opposite to the stem.

Download PDF sample

Rated 4.56 of 5 – based on 45 votes